View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11006_high_34 (Length: 250)

Name: NF11006_high_34
Description: NF11006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11006_high_34
NF11006_high_34
[»] chr4 (1 HSPs)
chr4 (115-206)||(40340798-40340893)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 115 - 206
Target Start/End: Complemental strand, 40340893 - 40340798
Alignment:
115 aaatattgttttgggttttatgttatatagctggaattggaatgggttgtacccattttctgtttcttg----aagattttattcgagtgatcctt 206  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||| |||||||||||    
40340893 aaatattattttgggttttatgttatatagctggaattggaatgggttgtacccattttctgtttcttgtataaagattttatttgagtgatcctt 40340798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University