View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11006_low_36 (Length: 241)
Name: NF11006_low_36
Description: NF11006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11006_low_36 |
 | |
|
| [»] scaffold0449 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 2622 - 2847
Alignment:
| Q |
1 |
cgttctagtgtcagcctagcttccatagctatgaggattgcagg-aacgtccttgtcacggactcacgtaacagtccatctgcgtaagctttcttgcttg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2622 |
cgttctagtgtcagcctagcttccatagctatgaggattgcagggaacgtccttgtcacggactcatgtaacagtccacctgcgtaagctttcttgcttg |
2721 |
T |
|
| Q |
100 |
tttcttcaatgcgtttttctggatatcttgttttgggtttaatggttggttcaagaattgatttatgagtttttggatttatcttcaatgcgtttttgtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2722 |
tttcttcaatgcgtttttctggatatcttgttttgggtttaatggttggttcaagaattgatttatgagtttttggatttatcttcaatgtgtttttgtg |
2821 |
T |
|
| Q |
200 |
catgtattggatggagaggaccttgt |
225 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
2822 |
catatattggatggagaggaccttgt |
2847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 11086572 - 11086657
Alignment:
| Q |
1 |
cgttctagtgtcagcctagcttccatagctatgaggattgcagg----aacgtccttgtcacggactcacgtaacagtccatctgc |
82 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| || || |||||| |||| ||||||||||| |||||||||| |
|
|
| T |
11086572 |
cgttctagtgtcagccttgcttcaatagctatgaggattgcggggcataatgtccttatcacagactcacgtaaaggtccatctgc |
11086657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University