View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11006_low_42 (Length: 203)
Name: NF11006_low_42
Description: NF11006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11006_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 73 - 130
Target Start/End: Original strand, 30397747 - 30397804
Alignment:
| Q |
73 |
ccagattcgattgccaaatttgcacatgacccattttccaaaacagaatctttttacc |
130 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30397747 |
ccagattcgattaccaaatttgcacatgacccattttccaaaacagaatctttttacc |
30397804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 73 - 130
Target Start/End: Original strand, 30404304 - 30404361
Alignment:
| Q |
73 |
ccagattcgattgccaaatttgcacatgacccattttccaaaacagaatctttttacc |
130 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30404304 |
ccagattcgattaccaaatttgcacatgacccattttccaaaacagaatctttttacc |
30404361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University