View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11007_high_16 (Length: 240)
Name: NF11007_high_16
Description: NF11007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11007_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 1135062 - 1135019
Alignment:
| Q |
179 |
catcacaaaataaaacgagttcagtaacatggaccctgctgata |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1135062 |
catcgcaaaataaaacgagttcagtaacatggatcctgctgata |
1135019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University