View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11007_high_4 (Length: 531)
Name: NF11007_high_4
Description: NF11007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11007_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 4e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 420 - 513
Target Start/End: Original strand, 31284859 - 31284952
Alignment:
| Q |
420 |
tttcaacataattatggaaaaagtgaaacaaggattgagttcttgtccaattgattatgaagtttctaataccatgttaagaatcagttattcc |
513 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
31284859 |
tttcaaaataattatggaaaaagtgaaacaaggattgagttattgtccaattgattatgaagtttctaatacaattttaagaatcagttattcc |
31284952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University