View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11007_low_17 (Length: 240)

Name: NF11007_low_17
Description: NF11007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11007_low_17
NF11007_low_17
[»] chr4 (1 HSPs)
chr4 (179-222)||(1135019-1135062)


Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 1135062 - 1135019
Alignment:
179 catcacaaaataaaacgagttcagtaacatggaccctgctgata 222  Q
    |||| |||||||||||||||||||||||||||| ||||||||||    
1135062 catcgcaaaataaaacgagttcagtaacatggatcctgctgata 1135019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University