View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11007_low_21 (Length: 212)
Name: NF11007_low_21
Description: NF11007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11007_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 25038649 - 25038469
Alignment:
| Q |
19 |
caatcatcaggtgcaacaccgaagaaccataaacctattttgttacatgcatgttcaaatttattagtaataaaaatcttgtatttgttatgattttccg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25038649 |
caatcatcaggtgcaacaccgaagaaccataaacctattttgttacatgcatgttgaaatttattagtaataaaaatcttgtatttgttatgattttccg |
25038550 |
T |
 |
| Q |
119 |
aaaaactttaactaactcgaattaatggcatcaggcttctcaaaatggttcaataggcatcaccttaaattgtcacaggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25038549 |
aaaaactttaactaactcgaattaatggcatcaggcttctcaaaatggttcaataggcatcaccttaaattgtcactggtt |
25038469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 25017542 - 25017381
Alignment:
| Q |
19 |
caatcatcaggtgcaacaccgaagaaccataaacctattttgttacatgcatgttcaaatttattagtaataaaaatcttgtatttgttatgattttccg |
118 |
Q |
| |
|
|||||| |||||||||||| ||| ||| |||||| | |||| || ||| ||||| ||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
25017542 |
caatcaccaggtgcaacactgaaaaactataaacttttttt-ttctatg-atgttaaaatttatttgtaataaaaatcttgtatttgttatgattgtcc- |
25017446 |
T |
 |
| Q |
119 |
aaaaactttaactaactcgaattaatggcatcaggcttctcaaaatggttcaataggcatcaccttaa |
186 |
Q |
| |
|
|||| ||||||| || |||||||||||| ||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
25017445 |
--aaacattaacta-cttgaattaatggcagcagtcttctcaaaatggttcaataggcatcagcttaa |
25017381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University