View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11007_low_8 (Length: 433)
Name: NF11007_low_8
Description: NF11007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11007_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 317 - 428
Target Start/End: Complemental strand, 3253639 - 3253529
Alignment:
| Q |
317 |
tttggatttcacaagactagtcgcttcaatcaac-aattgtgcattgcagtcctttgagtcgtt-tttgacttctaatggtaactcatcatcaccgcctt |
414 |
Q |
| |
|
||||||||| |||| ||| |||||||||| || |||||||||||| |||||| |||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3253639 |
tttggattttacaacactcatcgcttcaattcactaattgtgcattg---tcctttaagtctttctttgacttctaatggtaactcatcatcaccacctt |
3253543 |
T |
 |
| Q |
415 |
cttttcatctcact |
428 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
3253542 |
cttttcatgtcact |
3253529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 245 - 305
Target Start/End: Complemental strand, 3253686 - 3253626
Alignment:
| Q |
245 |
tataatgaagagacgcgtgtagggatcgatcatcacttggctattgatttggattttacaa |
305 |
Q |
| |
|
||||| |||||||| ||| ||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3253686 |
tataacgaagagacacgtttagggttctatcatcacttggctattgatttggattttacaa |
3253626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 43 - 102
Target Start/End: Complemental strand, 1693209 - 1693150
Alignment:
| Q |
43 |
aagccaagattgcatcaagaaaccctgacaaaaaagtcattgtgcattatcgggtcatca |
102 |
Q |
| |
|
||||||||||||||||||||||| || |||| ||||| | |||||||||||||||||||| |
|
|
| T |
1693209 |
aagccaagattgcatcaagaaactctaacaagaaagtgactgtgcattatcgggtcatca |
1693150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University