View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_high_17 (Length: 410)
Name: NF11008_high_17
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 378
Target Start/End: Complemental strand, 49421586 - 49421231
Alignment:
| Q |
19 |
agatgaatttgaaatattggatttaatcagatggttgtcctttgattgagtgtgtggctgtgtcgatttgttgtgatttgctacagtcaacaaattgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49421586 |
agatgaatttgaaatattggatttaatcggatggttgtcctttgattgagtgtgtggctgtgacgatttgttgtgatttgctacggtcaacaaattgaca |
49421487 |
T |
|
| Q |
119 |
cggtcacacggtcaatcatatcacaatcgtccgattaaatcaacagtaaataatcatcttctctattgtagaccctaaacacatgaaagcaaacagggaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49421486 |
cggtcacacggtcaatcatatcacaatcgtccgattaaatcaacagtaaataatcatcttctctattgtagaccctaaacacatgaaagcaagcagggaa |
49421387 |
T |
|
| Q |
219 |
cctatgcggtttgaatctctatggttgaaaccattcccaattaaaccgtgcatacttatccttctcgcattcacatgatcgtcaatccaatattggatct |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
49421386 |
cctatgcggtttgaatctccatggttgaaaccattcccaattaaaccgtgcatacttatccttctcgcattcacatgatcttcaatccaatattggatat |
49421287 |
T |
|
| Q |
319 |
catttcttcatcttgcatgcatccatggtataaaccccgccgcagctctggtcttcgacc |
378 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49421286 |
catttcttcatctt----gcatccatggcataaaccccgccgcagctctggtcttcgacc |
49421231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 104 - 163
Target Start/End: Original strand, 49419885 - 49419944
Alignment:
| Q |
104 |
gtcaacaaattgacacggtcacacggtcaatcatatcacaatcgtccgattaaatcaaca |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| ||||| | || ||||||||||||| |
|
|
| T |
49419885 |
gtcaacaaattgacacggtcacacagtcgatcataacacaaccatctgattaaatcaaca |
49419944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University