View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_high_21 (Length: 380)
Name: NF11008_high_21
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 36774327 - 36774125
Alignment:
| Q |
1 |
ttccgtagttagcaacttcctctttgcttcccaactctagtcacacgcgaagacaaggtatcaggtttgaaatttctatgcaacttattcacagcactta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36774327 |
ttccgtagttagcaacttcctctttgcttcccaactctagtcacacgcgacgacaaggtatcaggtttgaaatttctatgcaacttattcacggcactta |
36774228 |
T |
 |
| Q |
101 |
ttagttaaactggtttatgtgaagtagtatatgatacattattttcatcttaattagttcctctagtttgatcatggaccctatttcaacttctgaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774227 |
ttagttaaactggtttatgtgaagtagtatatgatacattattttcatcttaattagttcctctagtttgatcatggaccctatttcaacttctgaacag |
36774128 |
T |
 |
| Q |
201 |
ggc |
203 |
Q |
| |
|
||| |
|
|
| T |
36774127 |
ggc |
36774125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 203 - 367
Target Start/End: Complemental strand, 36774070 - 36773904
Alignment:
| Q |
203 |
cccttcttgccttctctcattattgaatctaattcatgcttataacagaccacaaaagttttattttacttctcgttcttcctacaaggcatgcacttat |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774070 |
cccttcttgccttctctcgttattgaatctaattcatgcttataacagaccacaaaagttttattttacttctcgttcttcctacaaggcatgcacttat |
36773971 |
T |
 |
| Q |
303 |
ttggtctttggcttttcgggt--cgattatctcaatgttatgtctttctcttttatattgtttgtct |
367 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36773970 |
ttggtctttggcttttcgggttccgattatctcaatgttatgtctttctcttttatattgtttgtct |
36773904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University