View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_high_29 (Length: 347)
Name: NF11008_high_29
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_high_29 |
 | |
|
| [»] scaffold0693 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0693 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 17 - 337
Target Start/End: Complemental strand, 5966 - 5649
Alignment:
| Q |
17 |
atttatagcatacggtgggctaaaaatcaaaattgttttgagtggaagcaaatatctatcaagagatccatgattaaggtgatgagctatctgagtagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5966 |
atttatagcatacggtgggctaaaaatcaaaattgttttgagtggaagcaaatatctatcaagagatccatgatgaaggtgatgagctatctgagtag-- |
5869 |
T |
|
| Q |
117 |
gctatccagagatgcagcaaaagcccaatcacctccttcattgtcttctacttcgacacctgatcgctgtaatttggttttgatggttgcctcctcccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5868 |
-ctatccagagatgcagcaaaagcccaatcgcctccttcattgtcttctacttcgacacctgatcgctgtaatttggttttgatggttgcctcctcccaa |
5770 |
T |
|
| Q |
217 |
tgacaatacaagataactgttgatgccgcaattcctcccatgatcagggtttacgattgcgtcattagagactcaaaaggatgcttcactgatgcttagt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5769 |
tgacaatacaagataactgttgatgccgcaattcctctcatgatcagggtctacgattgcgtcattagagactcaaaaggatgcttcactgatgcttagt |
5670 |
T |
|
| Q |
317 |
tctcacaacttcctctcatct |
337 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
5669 |
tctgacaacttcctctcatct |
5649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University