View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_high_35 (Length: 315)
Name: NF11008_high_35
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 43756189 - 43756496
Alignment:
| Q |
1 |
cttatttaaggttagcttcaataccttctgttatgccttttgattttctcaatttctcaattctctattttgtgaataccaatttt-atttgtatatgta |
99 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
43756189 |
cttatttgaggttagcttcaatactttctgttatgccttttgattttctcaatttctcaattctctattttgtgaataccaatttttatctgtatatgta |
43756288 |
T |
|
| Q |
100 |
aacttctgtagtgcttggaaaactttcacatgcactttctgtgcttgtctcccccttactgtgttgattctttgtttgtttttctcggattaaagcaaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43756289 |
aacttctgtagtgcttggaaaactttcacatgcactttctgtgcttgtctcccccttactgtgttgattctttgtttgtttttctcggattaaagcaaat |
43756388 |
T |
|
| Q |
200 |
atggaaaataaaatctttataatagtgcaatccactattttctagagcaggatcacat--tatatcatgtttccttcgtcatattttcctttaatttcta |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43756389 |
atggaaaataaaatctttataatagtgcaatccactattttctagagcaggatcacatgatatatcatgtttccttcgtcatattttcctttaatttcta |
43756488 |
T |
|
| Q |
298 |
gctctgtg |
305 |
Q |
| |
|
||| |||| |
|
|
| T |
43756489 |
gctttgtg |
43756496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University