View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_high_46 (Length: 254)
Name: NF11008_high_46
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_high_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 5601300 - 5601546
Alignment:
| Q |
1 |
tgtttatcgttttttattcttttgaaacatggttgtagttcaaacacatatatagcnnnnnnngtatgnnnnnnntaatgtttgcaatttcatttaggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
5601300 |
tgtttatcgttttttattcttttgaaacatggttgtagttcaaacacatatatagctttttt-gtatgaaaaaa-taatgttagcaatttcatttaggta |
5601397 |
T |
 |
| Q |
101 |
taagatttttgtggttcaaccccttttatcaaatctcgtgtggttgtcctttagttctcaacattgtttggctatgtactatgaactttcttaatcatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5601398 |
taagatttttgtggttcaaccccttttatcaactctcgtgtggttgtcctttagttctcaacattgtttggctatgtactatgaactttctcaatcatag |
5601497 |
T |
 |
| Q |
201 |
ctgactcatgacataatactaaatgctatttatcccatttcttctcact |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5601498 |
ctgactcatgacataatactaaatgctatttatcccatttcttatcact |
5601546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University