View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_low_28 (Length: 352)
Name: NF11008_low_28
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 1416582 - 1416485
Alignment:
| Q |
18 |
cacataggacaaaggaaaggaaagaggggaccctatagtgtgctctattgtcaaaactatactaattatatccactagagatatacatataacatata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416582 |
cacataggacaaaggaaaggaaagaggggaccctatagtgtgctctattgtcaaaactatactaattatatccactagagatatacatataacatata |
1416485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 117 - 341
Target Start/End: Complemental strand, 1416438 - 1416214
Alignment:
| Q |
117 |
ctgaaaataagcccaatgctcagtctgtaccatcaatcttcactatagctgaagagatnnnnnnnnnnnnnnnnnnnnnngaaagtaaacatcttgatca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1416438 |
ctgaaaataagcccaatgctcagtctgtaccatcaatcttcactatagctgaagagattctctctctctctctctctc--gaaagtaaacatcttgatca |
1416341 |
T |
|
| Q |
217 |
ttcctttcttcagttttagctgaagagatnnnnnnnnnnnnnnnnnnn--agttgtgaggaataattatttagttttgttgactaccgacacccttattt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416340 |
ttcctttcttcagttttagctgaagagattctctctctctatctctctctagttgtgaggaatatttatttagttttgttgactaccgacacccttattt |
1416241 |
T |
|
| Q |
315 |
ttcccaaaaaagacattctaccttcat |
341 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1416240 |
ttcccaaaaaagacattctaccttcat |
1416214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University