View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_low_38 (Length: 312)
Name: NF11008_low_38
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 12 - 297
Target Start/End: Complemental strand, 48088930 - 48088645
Alignment:
| Q |
12 |
aagaagtaggtggttaccaagaagattgcgcacgtcagcaaattggtgttgattggaagaacgagggattgtaggagtaaacaagaataagcaaatgcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48088930 |
aagaagtaggtggttaccaagaagattgcgcacgtcagcaaattggtgttgattggaagaacgagggattgtaggagtaaacaagaataagcaaatgcaa |
48088831 |
T |
|
| Q |
112 |
cagagaaatgttgcagttgccccccatatgcgatgatttctcttccaccttttgaaccggtgattcgttacataatccatcattctcctctttctcactt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48088830 |
cagagaaatgttgcagttgccccccatatgcgatgatttctcttccaccttttgaaccggtgattcgttacataatccatcattctcctctttctcactt |
48088731 |
T |
|
| Q |
212 |
cacttcaccaaccaaaagaaagaaacataaacagaacagaagagaagagagtgtggctctatgaaagcaaaggcaatgtttgatct |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48088730 |
cacttcaccaaccaaaagaaagaaacataaacagaacagaagagaagtgagtgtggctctatgaaagcaaaggcaatgtttgatct |
48088645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University