View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_low_41 (Length: 289)
Name: NF11008_low_41
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 5656303 - 5656024
Alignment:
| Q |
1 |
ctagcttctgatgctatagaaaatggatggtcaagatttgctttcactagctacatgagcaatatttcatcnnnnnnntcaacttcatcaacactattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
5656303 |
ctagcttctgatgctatagaaaatggatggtcaagatttgctttcactagctacatgagtaatatttcatcaaaaaaatcaacttcatcaacactattag |
5656204 |
T |
 |
| Q |
101 |
gatcatgtggaggtagtgatgaatttggaagagaaaatgaggctgaaataaactgggaagtttgtcaaggatcaaatgaattcatgcagaaggttagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656203 |
gatcatgtggaggtagtgatgaatttggaagagaaaatgaggctgaaataaactgggaagtttgtcaaggatcaaatgaattcatgcagaaggttagact |
5656104 |
T |
 |
| Q |
201 |
caatcctggtttaaaagagtgnnnnnnncatcttaacaacacttctacaagtgttgcttctgttattaggacttctctgc |
280 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656103 |
caatcctggtttaaaagagtgtttttttcatcctaacaacacttctacaagtgttgcttctgttattaggacttctctgc |
5656024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 47047669 - 47047714
Alignment:
| Q |
8 |
ctgatgctatagaaaatggatggtcaagatttgctttcactagcta |
53 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47047669 |
ctgatgctgttgaaaatggatggtcaagatttgctttcactagcta |
47047714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University