View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_low_43 (Length: 267)
Name: NF11008_low_43
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 25118143 - 25117906
Alignment:
| Q |
19 |
gagaacccaacatagggctattacaagtcgtcgctggcaaacgattgagtgcgacattgaagcaaagctctaaagccttgcattgaagagggtgagagtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118143 |
gagaacccaacatagggctattacaagtcgtcgctggcaaacgattgagtgcgacattgaagcaaagctctaaagccttgcattgaagagggtgagagtg |
25118044 |
T |
 |
| Q |
119 |
agattgaagacaagctgttcttaataatccattggtaacactaagcatagtgtttgcaacatgaagtggtgttacttgagcatggccacgacgctttgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118043 |
agattgaagacaagctgttcttaataatccattggtaacactaagcatcgtatttgcaacatgaagtggtgttacttgagcatggccacgacgctttgct |
25117944 |
T |
 |
| Q |
219 |
agggttattgcttgctttattatgtttgctgcttctgt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25117943 |
agggttattgcttgctttattatgtttgcagcttctgt |
25117906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 57 - 142
Target Start/End: Original strand, 40588775 - 40588860
Alignment:
| Q |
57 |
aaacgattgagtgcgacattgaagcaaagctctaaagccttgcattgaagagggtgagagtgagattgaagacaagctgttcttaa |
142 |
Q |
| |
|
||||| |||||||| |||||||| |||||||| | ||| |||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
40588775 |
aaacggttgagtgcaacattgaaacaaagctcaagagctttgcattgaagagggtgagagtgacattgaagacaagcttttcttaa |
40588860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University