View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11008_low_52 (Length: 250)
Name: NF11008_low_52
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11008_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 149 - 234
Target Start/End: Complemental strand, 48011132 - 48011047
Alignment:
| Q |
149 |
taatgtcacattgttaaatgtttatatttttatcagaaaacaagaaatggaaatagactgtagtaacggaaactatgtaggcctat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011132 |
taatgtcacattgttaaatgtttatatttttatcagaaaacaagaaatggaaatagactgtagtaacggaaactatgtaggcctat |
48011047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 48011263 - 48011180
Alignment:
| Q |
18 |
aatgaaaacaagatatctaatgcatcaaaaaatttctgcattatttcccggcacatatctgctaggagtttaaagatttgtgat |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011263 |
aatgaaaacaagatatctaatacatcaaaaaatttctgcattatttcccggcacatatctgctaggagtttaaagatttgtgat |
48011180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University