View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11008_low_59 (Length: 212)

Name: NF11008_low_59
Description: NF11008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11008_low_59
NF11008_low_59
[»] chr1 (1 HSPs)
chr1 (1-200)||(42306908-42307107)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 42307107 - 42306908
Alignment:
1 ccgaactttgaaaattacaatgcatgaaaacaactgcagacacatgcatattggggcagtgccttacagctgtggataatacaacaaaaacacaaattaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42307107 ccgaactttgaaaattacaatgcatgaaaacaactgcagacacatgcatattggggcagtgccttacagctgtggataatacaacaaaaacacaaattaa 42307008  T
101 atacaaataaacgcagccctctaaacaatcttaatcaaatgctgacgaaatatatgtgaagaatccccttgatcttctttgtgcatggctttctctgctt 200  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
42307007 atacaaataaacggagccctctaaacaatcttaatcaaatgctgacgaaatatatgtgaagaatccccttgatcttctttgtgcatggctttctttgctt 42306908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University