View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11009_high_18 (Length: 310)
Name: NF11009_high_18
Description: NF11009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11009_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 47120077 - 47119787
Alignment:
| Q |
1 |
atgattcattgtgattatgcataagctaattagttacccgtggtattcttcggcggtgatatcatagcctagtgcgcgtaaaccggcgagggtgctaccg |
100 |
Q |
| |
|
||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120077 |
atgatccactgtgattatgcataagctaa---gttacccgtggtattcttcggcggtgatatcatagcctagtgcgcgtaaaccggcgagggtgctaccg |
47119981 |
T |
 |
| Q |
101 |
tgggatttaaagagttcaaccctcagggtggaggctttggattgtgagaaaccacatttttccattagaaagagatcgatatttttcttaacagcagctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47119980 |
tgggatttaaagagttcaaccctcagggtggaggctttggattgtgagaaaccacatttttccattagaaagagatcgatatttttcttaacggcagctc |
47119881 |
T |
 |
| Q |
201 |
cgattccggtgttggatgggtacaaggtatcatccaaatctgtttgataaacaattgaattagagaaaatgatattgaatgagtttgtaaattg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119880 |
cgattccggtgttggatgggtacaaggtatcatccaaatctgtttgataaacaattgaattagagaaaatgatattgaatgagtttgtaaattg |
47119787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University