View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11009_high_29 (Length: 236)
Name: NF11009_high_29
Description: NF11009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11009_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 33720732 - 33720851
Alignment:
| Q |
102 |
atacatgaactacgccttcttcactaccaccctcacctccgatcaagaactctcagtcatcgtcgctgccctaaccaacgtagtctccggttccacctcc |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33720732 |
atacatgaactacgccttctccactaccaccctcacctccgatcaagaactctcagtcatcgtcgctgccctaaccaacgtagtctccggttccacctcc |
33720831 |
T |
|
| Q |
202 |
accgtcggcttagagcgaat |
221 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
33720832 |
accgtcggcttagatcgaat |
33720851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 205
Target Start/End: Original strand, 33735372 - 33735444
Alignment:
| Q |
133 |
ctcacctccgatcaagaactctcagtcatcgtcgctgccctaaccaacgtagtctccggttccacctccaccg |
205 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
33735372 |
ctcacctccgatcaagaactctccgccatcgttgctgctttaaccaacgtagtctccggctccacctccaccg |
33735444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 205
Target Start/End: Original strand, 33750190 - 33750262
Alignment:
| Q |
133 |
ctcacctccgatcaagaactctcagtcatcgtcgctgccctaaccaacgtagtctccggttccacctccaccg |
205 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| ||||||| || |||||||| ||||||||||||| |
|
|
| T |
33750190 |
ctcacctccgatcaagaactctctgtcatcgtctctgccttaaccaatgtcgtctccggctccacctccaccg |
33750262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 33720661 - 33720719
Alignment:
| Q |
1 |
ataaaccaacccaaatctctgccttacccttcaacttcaaaatcttccaaaccttcaaa |
59 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
33720661 |
ataaaccaactcaaatctctgactttcccttcaacttcaaaatcttctaaaccttcaaa |
33720719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 205
Target Start/End: Original strand, 33718706 - 33718783
Alignment:
| Q |
128 |
ccaccctcacctccgatcaagaactctcagtcatcgtcgctgccctaaccaacgtagtctccggttccacctccaccg |
205 |
Q |
| |
|
|||| ||| ||||||||||||||| || ||||| ||| | ||||||||||| || |||||||| |||||||| |||| |
|
|
| T |
33718706 |
ccactctcccctccgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcgtctccggctccacctcaaccg |
33718783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University