View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11009_high_9 (Length: 471)
Name: NF11009_high_9
Description: NF11009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11009_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 424; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 17 - 460
Target Start/End: Original strand, 29052770 - 29053213
Alignment:
| Q |
17 |
acatcaccaacatgctgcaacagaaaacggagagaataatgatgaagtatcaggaatggctaaagcatttcacatatcatcaagaacagcttctgctata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052770 |
acatcaccaacatgctgcaacagaaaacggggagaataatgatgaagtatcaggaatggctaaagcatttcacatatcatcaagaacagcttctgctata |
29052869 |
T |
|
| Q |
117 |
acaatatgtatagtaatggctgcacttgtttttcctttgtttatgacatctttaggacaaggtttggcattgaagacaaagatgttatcatatggaacac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052870 |
acaatatgtatagtaatggctgcacttgtttttcctttgtttatgacatctttaggacaaggtttggcattgaagacaaagatgttatcatatggaacac |
29052969 |
T |
|
| Q |
217 |
ttttgtttggattttacatggcttggaacattggtgctaatgatgttgcaaatgcaatgggaacttctgttggatctggtgcattgtcacttaggcaagc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29052970 |
ttttgtttggattttacatggcttggaacattggtgctaatgatgttgcaaatgcaatgggaacttcagttggatctggtgcattgtcacttaggcaagc |
29053069 |
T |
|
| Q |
317 |
tgtgttaacagctgcagtgttggagttttctggggcattgttgatgggaactcatgtgacaagtacaatgcagaagggaattcttgttgctaatgttttt |
416 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29053070 |
tgtgttgacagctgcagtgttggagttttcaggggcattgttgatgggaactcatgtgactagtacaatgcagaagggaattcttgttgctaatgttttt |
29053169 |
T |
|
| Q |
417 |
caggggaaggatactttgctttttgcagggttgctttcttctct |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29053170 |
caggggaaggatactttgctttttgcagggttgctttcttctct |
29053213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University