View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11009_low_15 (Length: 402)
Name: NF11009_low_15
Description: NF11009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11009_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 65 - 126
Target Start/End: Complemental strand, 37215465 - 37215406
Alignment:
| Q |
65 |
gtatgcaattttaattatgtatatttacacatgagttgcacttacaaatttcaggggtggaa |
126 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
37215465 |
gtatgcaattttaattacgtatatttaca--tgagttgcacttacaaatttcagggatggaa |
37215406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 37215108 - 37215072
Alignment:
| Q |
19 |
gtaagtgtagattcaatatcatttggtgttcacatgc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215108 |
gtaagtgtagattcaatatcatttggtgttcacatgc |
37215072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 260 - 317
Target Start/End: Complemental strand, 37216072 - 37216015
Alignment:
| Q |
260 |
caattttaattatgctatatttacatgagtcacatctatcaatttcaggggtcaaact |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||| ||||||||||| ||||| |
|
|
| T |
37216072 |
caattttaattatgttatatttacatgagttgcatttatcgatttcaggggtgaaact |
37216015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 265 - 311
Target Start/End: Complemental strand, 37218447 - 37218402
Alignment:
| Q |
265 |
ttaattatgctatatttacatgagtcacatctatcaatttcaggggt |
311 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
37218447 |
ttaattatgttatatttacatga-tcacatttatcaatttcaggggt |
37218402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University