View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11009_low_23 (Length: 269)
Name: NF11009_low_23
Description: NF11009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11009_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 21599157 - 21599395
Alignment:
| Q |
18 |
attcttgatacaggtttaccaattgttgctactttcattctttttctttttctatcatctctaaaatggcatagattttataacagaaaatcaagtcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21599157 |
attcttgatacaggtttaccaattgttgctactttcattctttttctttttctatcatctctaaaatggcatagattttataacagaaaatcaagtcaat |
21599256 |
T |
 |
| Q |
118 |
taagttttgctatttgctccaaaaaacttgaannnnnnnagtttggtaaaattttgagtgttgaagatatggcacttactgtatactttaaatacattgt |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21599257 |
taagttttgttatttgctccaaaaaacttgaatttttttagtttggtaaaattttgagtgttgaagatatggcacttactgtatactttaaatacattgt |
21599356 |
T |
 |
| Q |
218 |
aaccattaactggttaaatatattgctcttttcacttct |
256 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
21599357 |
aaccattaactggttaaatctatcgctctttttacttct |
21599395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University