View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11010_low_10 (Length: 280)
Name: NF11010_low_10
Description: NF11010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11010_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 35 - 266
Target Start/End: Complemental strand, 33758782 - 33758549
Alignment:
| Q |
35 |
ttaactttatataatgtatcaaatggatggattttaggattcctgatatttagtcatatcaaatgagagagttcttgaacggtctctttcagagtccctg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758782 |
ttaactttatataatgtatcaaatggatggattttaggattcctgatatttagtcatatcaaatgagagagttcttgaacggtctctttcagagtccctg |
33758683 |
T |
|
| Q |
135 |
taacccaacctaatgttttagctttgtcttttgttgtcaaaataatacaacataaatcttctttattgagatgtttgaacataacttcaaattgcaaccc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758682 |
taacccaacctaatgttttagctttgtcttttgttgtcaaaataatacaacataaatcttctttattgagatgtttgaacataacttcaaattgcaaccc |
33758583 |
T |
|
| Q |
235 |
tcgcattataact--atattgcaacacccacagg |
266 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33758582 |
tcgcattataactacatattgcaacacccacagg |
33758549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University