View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11010_low_15 (Length: 229)
Name: NF11010_low_15
Description: NF11010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11010_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 37527696 - 37527500
Alignment:
| Q |
14 |
gcagagagtaagagacaacaaagatcttgatgtcacatatcgcgatcaagaattctttttgaaaaaaccttggcctcatggacatgatactatggttgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37527696 |
gcagagagtaagagacaacaaagatcttgatgtcgcatatcgcgatcaagaattctttttgaaaaaaccttggcctcatggacatgatactatggttgat |
37527597 |
T |
 |
| Q |
114 |
attatgattcaacaaaatctagaactctagtattttgaatttgacacaaaagaagtggttgccaaannnnnnnnacgttcgaatttcgcctgagaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37527596 |
attatgattcaacaaaatctagaactctagtattttgaatttgacacaaaagaagtggttgccaaattttttttacgttcgaatttcgcctgagaac |
37527500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University