View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11010_low_8 (Length: 321)
Name: NF11010_low_8
Description: NF11010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11010_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 321
Target Start/End: Original strand, 40177585 - 40177892
Alignment:
| Q |
14 |
atcatgttgaatatttatctactagaacttatcttcttgcaaatgtttattttaaccaatttcgccttctttcaggcatacaannnnnnngacctctact |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40177585 |
atcatgttgaatatttatctactagaacttatcttcttgtaaatgtttattttaaccaatttcgccttctttcaggcatacaatttttttgacctctact |
40177684 |
T |
 |
| Q |
114 |
atggatttggccgaacctttttcaacccagccagtgtaagctttaccttgtactttactgaaatacaaatgtgtgcgtgcgcacgcgcatacatacatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40177685 |
atggatttggccgaacctttttcaacccagccagtgtaagctttaccttgtacttttctgaaatacaaatgtgtgcgtgcgcacgcgcatacatacatat |
40177784 |
T |
 |
| Q |
214 |
attatatatacattgttagacattttccatttttcatgctggtaaatatgtggtttgacttcaaaatgacaggcaagtgtgttgtcgagatttgatgctt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40177785 |
attatatatacattgttagacattttccatttttcatgctggtaaatatgtggtttgacttcaaaatgacaggcaagtgtgttatcgagatttgatgctt |
40177884 |
T |
 |
| Q |
314 |
tgcaaaaa |
321 |
Q |
| |
|
|||||||| |
|
|
| T |
40177885 |
tgcaaaaa |
40177892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University