View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11011_high_13 (Length: 230)
Name: NF11011_high_13
Description: NF11011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11011_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 7259728 - 7259952
Alignment:
| Q |
1 |
gataaaccaattcaacatgtcctgatgagcctcttctgcattcttaactgcaacttcatcttcaacattgtacctcaatgtccatccatgactaacacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
7259728 |
gataaaccaattcaacatgtcctgatgagcctcttctgcattcttaactgcaacttcatcttcaacactgtatctcaatgtccatccatgactaacacca |
7259827 |
T |
 |
| Q |
101 |
gggtacaacttcacaatgctttctaactgtcatagcatacataacttgaagtcttaagttttgaaaggaaatttaattaagataatcaacaaacaattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7259828 |
gggtacaacttcacaatgctttctaactgtcatagcatacataacttgaagtcttaagttttgaaaggaaatttcattaagataatcaacaaacaattct |
7259927 |
T |
 |
| Q |
201 |
tccatagtt--tctcacctttgctt |
223 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
7259928 |
tccatagtttctctcacctttgctt |
7259952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University