View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11011_high_6 (Length: 350)
Name: NF11011_high_6
Description: NF11011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11011_high_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 10 - 350
Target Start/End: Complemental strand, 44333478 - 44333138
Alignment:
| Q |
10 |
agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333478 |
agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca |
44333379 |
T |
|
| Q |
110 |
gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333378 |
gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga |
44333279 |
T |
|
| Q |
210 |
agtggttattttccaatgatgtcaggttttgtccctgtctcttctagttctaattctcctcgtatgtattcttctagtgctgctcttttggggtctagtt |
309 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333278 |
agtggctattttccaatgatgtcaggttttgtccctgtctcttctagttctaattctcctcgtatgtattcttctagtgctgctcttttggggtctagtt |
44333179 |
T |
|
| Q |
310 |
catgggttggacataaaagagggcgcgaagatggtcttctt |
350 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
44333178 |
catgggttggacataaaagagtgcgtgaagatggtcttctt |
44333138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University