View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11011_high_7 (Length: 339)
Name: NF11011_high_7
Description: NF11011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11011_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 40 - 325
Target Start/End: Original strand, 9661651 - 9661937
Alignment:
| Q |
40 |
agactaaattttgatgatgacaagatgaataactaaagaacccaataacacaaagagttaatattacaaacc-aaaaagagatcaagaacgaaggttgga |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9661651 |
agactaaattttgatgatgacaagatgaataactaaagaacccaagaacacaaagagttaatattacaaaccgaaaaagagatcaagaacgaaggttgga |
9661750 |
T |
 |
| Q |
139 |
ttttgaaggaagagaagtggtgggaccctcaaaaggaagatgagaaacaggcttagtaaccatgagaggaagatcatcgttgttgttatcatcttcaatg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9661751 |
ttttgaaggaagagaagtggtgggaccctcaaaaggaagatgagaaacaggggtagtaaccatgagaggaagatcatcgttgttgttatcatcttcaatg |
9661850 |
T |
 |
| Q |
239 |
tcagtggtggtaaggttgatgcaagaacaacgttccaaggaagcaaagaaagcagaagccacgttggtgccgacccagttggcaact |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9661851 |
tcagtggtggtaaggttgatgcaagaacaacgttccaaggaagcaaagaaagcagaagccacgttggtgccgacccagttggcaact |
9661937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University