View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11011_high_9 (Length: 301)
Name: NF11011_high_9
Description: NF11011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11011_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 292
Target Start/End: Original strand, 41916452 - 41916726
Alignment:
| Q |
18 |
agttgattcctttaaactcttttgtatctattagtgtttgtcttcaaccattgttcacatctttgtctttctcattcttctcttttatttttgtcaaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41916452 |
agttgattcctttaaactcttttgtatctattagtgtttgtcttcaaccattgttcacatctttgtctttctcattcttctcttttgtttttgtcaaaaa |
41916551 |
T |
|
| Q |
118 |
ctactatttcaaatggatcgtttttcttctactactatcccttttgcattacatggagcaaaagatgacctaaccatgcagatttctttgatttggagcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41916552 |
ctactatttcaaatggatcgtttttcttctactactatcccttttgcattacaaggagcaaaagatgacctaaccatgcagatttctttgatttggagcc |
41916651 |
T |
|
| Q |
218 |
aaatcaaagctccattaatcgttccattactaagaatatcagtgtttttgtgtttgataatgtcggtgatgatgt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41916652 |
aaatcaaagctccattaatcgttccattactaagaatatcagtgtttttgtgtttgataatgtcggtgatgatgt |
41916726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University