View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11011_low_17 (Length: 223)
Name: NF11011_low_17
Description: NF11011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11011_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 50228783 - 50228974
Alignment:
| Q |
18 |
atttcagcactatacaacgtagcaattacgttacgtttgtgtggacactgatatgggtaagaaacttgatgcattgctgggtagaaacttcaaagctgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50228783 |
atttcagcactatacaacgtagcaattacgttacgtttgtgtggacactgatatgggtaagaaacttgatgcattgctgggtagaaacttcaaagctgac |
50228882 |
T |
|
| Q |
118 |
aaattcaagcctaccattaaccttgccatatcgcgtcttgctgttctcaagaatcaacgtaacgtgcgtctcagacaatcccgttctgatgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50228883 |
aaattcaagcctaccattaaccttgccatatcgcgtcttgctgttctcaagaatcaacgtaatgtgcgtctcagacaatcccgttctgatgt |
50228974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University