View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11011_low_5 (Length: 404)
Name: NF11011_low_5
Description: NF11011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11011_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 17 - 355
Target Start/End: Original strand, 401731 - 402069
Alignment:
| Q |
17 |
acatcagttgtcacagatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401731 |
acatcagttgtcacagatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggc |
401830 |
T |
|
| Q |
117 |
aagacttcagaggtttgttccacctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctgg |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401831 |
aagacttcagaggtttgttccatctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctgg |
401930 |
T |
|
| Q |
217 |
catctcataaatacaatctcgattttattcccagttaaaccagccggcttcaagcaattgagagagnnnnnnnnggtcttccaacacccttcaaacacag |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
401931 |
catctcataaatacaatctcgattttatccacagttaaaccagccggcttcaagcaattgagagagttttttttggtcttccaacacccttcaaacacag |
402030 |
T |
|
| Q |
317 |
aaaccaattgtttgggttagcagcctcccagcacaccat |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
402031 |
aaaccaattgtttgggttagcagcctcccagcacaccat |
402069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University