View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11012_high_4 (Length: 238)
Name: NF11012_high_4
Description: NF11012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11012_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 28929566 - 28929771
Alignment:
| Q |
15 |
aagaacaagtgagtgacaaaccttaatcttccaatccaaaactataaccgtcggatcctttgaatcaaccccccataataatgacaactcatgacgactc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28929566 |
aagaacaagtgagtgacaaaccttaatcttccaatccaaaactataaccgtcggatcctttgaatcaaccccccataataatgacaactcatgacgactc |
28929665 |
T |
 |
| Q |
115 |
atgactacattgctggttcgcgcctgctcataataatgagcccacaccagaacctcacgccacggttgttggggacgaagaaagtagagttttagacctc |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28929666 |
atgacaacattgctggttcgcgcctgctcataataatgagcccacaccagaacctcacaccacggttgttggggacgaagaaagtagagttttagacctc |
28929765 |
T |
 |
| Q |
215 |
gtgatt |
220 |
Q |
| |
|
|||||| |
|
|
| T |
28929766 |
gtgatt |
28929771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University