View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11014_high_29 (Length: 249)
Name: NF11014_high_29
Description: NF11014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11014_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 39322300 - 39322446
Alignment:
| Q |
16 |
cactagctaggttgataatttagttgagtttaataatagttgataaacaatttccccttcaagaatttcaaagtagcgtattatattaatatgcaaattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39322300 |
cactagctaggttgataatttagttgagtttaataatagttgataaacaatttccccttcaagaatttcaaagtagcgtattatattaatatgcaaattc |
39322399 |
T |
 |
| Q |
116 |
ctgttcgaaaaaataaaatcagtcacatattatggtcagtgtacaaa |
162 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39322400 |
ctgttcgaaaaaataaaatcattcacatattatggtcagtgtacaaa |
39322446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 39322444 - 39322492
Alignment:
| Q |
185 |
aaataatttacaaatatgcaaaagtaaagttccaggatggcacacaggt |
233 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39322444 |
aaataatttacaaataagcaaaagtaaagttccaggatggcacacaggt |
39322492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University