View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11015_low_2 (Length: 217)
Name: NF11015_low_2
Description: NF11015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11015_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 42883959 - 42884123
Alignment:
| Q |
20 |
caggcaacatactgaatttattttttatttcaggatgaattggaagcagaacttgaagagctagagggtgctgagttggaagaacagcttcttcagccta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42883959 |
caggcaacatactgaatttattttttatttcaggatgaattggaagcagaacttgaagagctagagggtgctgagttggaagaacagcttcttcaaccta |
42884058 |
T |
|
| Q |
120 |
caattacaactccagcagccccggtgcatgtcccagctgggcagcaacatacccaccctgtgtct |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42884059 |
caattacaactccagcagccccggtgcatgtcccagctgggcagcaacatacccaccctgtgtct |
42884123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 48 - 157
Target Start/End: Complemental strand, 42889376 - 42889267
Alignment:
| Q |
48 |
ttcaggatgaattggaagcagaacttgaagagctagagggtgctgagttggaagaacagcttcttcagcctacaattacaactccagcagccccggtgca |
147 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
42889376 |
ttcaggatgaactggaagcagaacttgaagagctagagggtgctgagttggaagaacagcttcttcagcctgcaattacaactccagaagcctcggtgca |
42889277 |
T |
|
| Q |
148 |
tgtcccagct |
157 |
Q |
| |
|
|||||||||| |
|
|
| T |
42889276 |
tgtcccagct |
42889267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 31 - 132
Target Start/End: Original strand, 34406580 - 34406681
Alignment:
| Q |
31 |
ctgaatttattttttatttcaggatgaattggaagcagaacttgaagagctagagggtgctgagttggaagaacagcttcttcagcctacaattacaact |
130 |
Q |
| |
|
||||||||||| || |||||||||||| | ||||||||||||||||| | ||| ||||||||||||||||||||||||||||||| ||| ||||| || |
|
|
| T |
34406580 |
ctgaatttattgttcttttcaggatgaactagaagcagaacttgaagaattggagagtgctgagttggaagaacagcttcttcagccaacatttacagct |
34406679 |
T |
|
| Q |
131 |
cc |
132 |
Q |
| |
|
|| |
|
|
| T |
34406680 |
cc |
34406681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University