View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11016_high_17 (Length: 412)
Name: NF11016_high_17
Description: NF11016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11016_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 12 - 393
Target Start/End: Complemental strand, 48085571 - 48085210
Alignment:
| Q |
12 |
cacagaaagaaatgtttgcactaggattgaatcaaaggaagacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085571 |
cacagaaagaaatgtttgcactaggattgaaacaaaggaagacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaa |
48085472 |
T |
 |
| Q |
112 |
accactagctatggaatacaaaacaaaagattaatggataaattaaagggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48085471 |
accactagctatggaatacaaaacaaaag--------------------gacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaa |
48085392 |
T |
 |
| Q |
212 |
atgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggatttggttg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48085391 |
atgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggattcggttg |
48085292 |
T |
 |
| Q |
312 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttgagg |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48085291 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaaagcattaagttctctgtttgggcacaagtttgagg |
48085210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 318 - 363
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
| Q |
318 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48102536 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
48102491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 324 - 388
Target Start/End: Complemental strand, 1809590 - 1809526
Alignment:
| Q |
324 |
tttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtt |
388 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||| | |||||||| ||||||||||| |
|
|
| T |
1809590 |
tttgccttttcagatggatggaatggatcccaaaatacatacaagtctctgttagggcacaagtt |
1809526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 321 - 388
Target Start/End: Original strand, 7385568 - 7385635
Alignment:
| Q |
321 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||| |||| ||||||||| |
|
|
| T |
7385568 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatttaagtctctatttgagcacaagtt |
7385635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 312 - 391
Target Start/End: Original strand, 35376267 - 35376346
Alignment:
| Q |
312 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttga |
391 |
Q |
| |
|
||||||||| || | || ||||||||||||||||||| |||||||||||||| ||| |||| ||| ||||||||||||| |
|
|
| T |
35376267 |
actatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctcgattttggcacaagtttga |
35376346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 391
Target Start/End: Original strand, 35357711 - 35357791
Alignment:
| Q |
311 |
gactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttga |
391 |
Q |
| |
|
|||||||||| || | || |||||||||||||| ||||||||||||||||||| ||| | || ||||||||||| ||||| |
|
|
| T |
35357711 |
gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcataaaggtttcgatttgggcacaattttga |
35357791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 390
Target Start/End: Original strand, 35364521 - 35364581
Alignment:
| Q |
330 |
ttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttg |
390 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| || |||| ||| |||||||||||| |
|
|
| T |
35364521 |
ttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcacaagtttg |
35364581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University