View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11016_high_20 (Length: 338)
Name: NF11016_high_20
Description: NF11016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11016_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 17 - 327
Target Start/End: Complemental strand, 52565541 - 52565231
Alignment:
| Q |
17 |
aatataaagggtggaagtggatcatatatgtatacctttgggcctcttggtccactcctccagagaggggtcttagtggtgttgcaatcagagcaaaccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565541 |
aatataaagggtggaagtggatcatatatgtatacctttgggcctcttggtccactcctccagagaggggtcttagtggtgttgcaatcagagcaaaccc |
52565442 |
T |
 |
| Q |
117 |
taatagttgaataattattgctgctgctattatctgttccttgtggtgacagtggttgcttttgatcttcaaacttaatctgcttagagttgcttgttaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52565441 |
taatagttgaataattattgctgctgctattatctgttccttgtggtgacagtggttgcttttgatcttcaaacttaatctgtttagagttgcttgttaa |
52565342 |
T |
 |
| Q |
217 |
gttagaactgcccgtttgatcagaaatcatcatcttcttcattattctcatctttgaagacatccacttcaccgaagtaccatcctgatcagcttcttga |
316 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565341 |
gttagaactgcccgtttgatcagaaaccatcatcttcttcattattctcatctttgaagacatccacttcaccgaagtaccatcctgatcagcttcttga |
52565242 |
T |
 |
| Q |
317 |
ttgttattcat |
327 |
Q |
| |
|
||||||||||| |
|
|
| T |
52565241 |
ttgttattcat |
52565231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 119
Target Start/End: Original strand, 16954777 - 16954833
Alignment:
| Q |
63 |
ttggtccactcctccagagaggggtcttagtggtgttgcaatcagagcaaaccctaa |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
16954777 |
ttggtccacttctccagagaggggtcttagttgtgtggcaatcagtacaaaccctaa |
16954833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University