View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11016_high_30 (Length: 253)
Name: NF11016_high_30
Description: NF11016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11016_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 240
Target Start/End: Complemental strand, 12065485 - 12065260
Alignment:
| Q |
15 |
atgaatataagagaaagagcgctgctactaacccaatttcataaaagataaactttataacatgagaaagagagagtcatatatatttaattatgaaaaa |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065485 |
atgaatataagagaaagagcactgctactaacccaatttcataaaagataaactttataacatgagaaagagagagtcatatatatttaattatgaaaaa |
12065386 |
T |
|
| Q |
115 |
gtatgaaacacaaggttgttatacatatcaagtttacgggctagtagaaagagagagcagttacattattcatttgccatagttgcaatgatcactcaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065385 |
gtatgaaacacaaggttgttatacatatcaagtttacgggctagtagaaagagagagtagttacattattcatttgccatagttgcaatgatcactcaca |
12065286 |
T |
|
| Q |
215 |
ttatacttttgctgaaatatattttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
12065285 |
ttatacttttgctgaaatatattttc |
12065260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 12101799 - 12101862
Alignment:
| Q |
177 |
acattattcatttgccatagttgcaatgatcactcacattatacttttgctgaaatatattttctg |
242 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
12101799 |
acattattcacttgccatagtgtcaatgatcactcacat--tacttttgctgaaatattttttctg |
12101862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University