View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11016_high_34 (Length: 240)
Name: NF11016_high_34
Description: NF11016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11016_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 3599168 - 3599393
Alignment:
| Q |
4 |
atgtttcccttctgaatttatcagacgctgtcatcttctgatctacgtgatccttccatttctgctcttatagcggccaaaatgaaggagttccatgatc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3599168 |
atgtttcccttctgaatttatcagacgctgtcagcttctgatctacgtgatccttccatttctgctcttatagcggccaaaatgaaggagttccatgatc |
3599267 |
T |
|
| Q |
104 |
tagatatgcctggtgaaaagaaagccaatctttggcctacattgaggtatgtacataataagaa------taagaatttagttgtgtttaatttgtttaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3599268 |
tagatatgcctggtgaaaagaaagccaatctttggcctacattgaggtatgtacataataagaataagagtaagaatttagttgtgtttaatttgtttaa |
3599367 |
T |
|
| Q |
198 |
aaattttacttaaatagttaagtttc |
223 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
3599368 |
aaaatttacttaaatagttaagtttc |
3599393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 52 - 117
Target Start/End: Complemental strand, 15546411 - 15546346
Alignment:
| Q |
52 |
gatccttccatttctgctcttatagcggccaaaatgaaggagttccatgatctagatatgcctggt |
117 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
15546411 |
gatccatctatttctgctcttatagcctccaaaatgaaggagttccatgatcttgacatgcctggt |
15546346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University