View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11016_low_11 (Length: 451)
Name: NF11016_low_11
Description: NF11016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11016_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 155 - 432
Target Start/End: Complemental strand, 10056457 - 10056189
Alignment:
| Q |
155 |
aaaggatgacctcactttcaacgcgaaactatgtagactcttctaatctacaccatatagataaatttcagacaaagcatgcacatatatcacaactcta |
254 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10056457 |
aaagggtgacctcactttcaacgtgaaattatgtagactcttctaatctacaccatatagataaatttcagacaaagcatgcatatatatcacaactcta |
10056358 |
T |
 |
| Q |
255 |
gaattgccatttccataacaaagaagtaagattacaacaaagatagaatacaaaacaaagtgctacttataaattggtgccaaatagtgacaaacataac |
354 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10056357 |
gaattgcaatttccataacaaagaagtaagattacaacaaagatagaat---------agtgctacttataaattggtgccaaatagtgacaaacataac |
10056267 |
T |
 |
| Q |
355 |
cgaggtttatgttgtatgtgtaaacaagttttaaactaacacgtgtcctaagtcgtgtcccctttgagttccccttct |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10056266 |
cgaggtttatgttgtatgtgtaaacaagttttaaactaacacgtgtcctaagtcgtgtcccctttgagttctccttct |
10056189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 73 - 105
Target Start/End: Complemental strand, 52546142 - 52546110
Alignment:
| Q |
73 |
attaaaatttagattatccaatctcaatccaac |
105 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
52546142 |
attaaaatttagatcatccaatctcaatccaac |
52546110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University