View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11016_low_37 (Length: 238)
Name: NF11016_low_37
Description: NF11016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11016_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 8 - 190
Target Start/End: Complemental strand, 13464719 - 13464535
Alignment:
| Q |
8 |
atttagtgatcaatttttaaaatcgttcactttttagaccaaaataaatactaaattagtcgatagatatcatacagcaatcatataattttagtccgac |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
13464719 |
atttagtgatcaatttttaaaatcgatcactttttagaccaaaataaatactaaattagttgatagataccatacaacaatcatataattttagtccgac |
13464620 |
T |
 |
| Q |
108 |
gtttatttttatatcttgcaaaacaagtctaatgc--ataaattttaagatgaatttttgatcaagacataggagtttatatact |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
13464619 |
gtttatttttatatcttgcaaaacaagtctaatgcatataaattttaagatgaatttctgatcaagacataagagtctatatact |
13464535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University