View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_high_17 (Length: 297)
Name: NF11018_high_17
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 115 - 276
Target Start/End: Original strand, 27599292 - 27599442
Alignment:
| Q |
115 |
ctctctcattcaatcacttaatttagtggcaatcaaatttttatggttccttctattgaagttgatcctattttacttcaaaataaaccaccgatattaa |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
27599292 |
ctctctcattcaatcacttaatttactggcaatcaaatttttatggttccttctattgaagttgatcctatt-----------tgagccaccgatattaa |
27599380 |
T |
|
| Q |
215 |
atatgagcacctttcatagtcgagatttgaacttcaatttacgatgttatgggagtttagtc |
276 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27599381 |
atatgagcacctttcatagtcaggatttgaacttcagtttaccatgttatgggagtttagtc |
27599442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University