View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_high_18 (Length: 259)
Name: NF11018_high_18
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 52113261 - 52113493
Alignment:
| Q |
19 |
gtttgggtttgaggaaatgaatgggcctggtggcatattagcgcgaaaaatggttgatttgtatttgtgcattttacttctgaaatatttgtcgcggccg |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52113261 |
gtttgggttagaggaaatgaatgggcctggtggcatattagcgcgaaaaatggttgatttgtatttgtgcattttgcttctgaaatatttgtcgcggccg |
52113360 |
T |
|
| Q |
119 |
ccttcgttgtagaaatattcaagacggtctttgataggacctacgaatgggaggccgtaatctccagggattcttcgcattgaaagttttttgggtggtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52113361 |
ccttcgttgtagaaatattcaagacggtctttgataggacctacgaatgggaggccgtaatctccagggattcttcgcattggaagttttttgggtggtt |
52113460 |
T |
|
| Q |
219 |
cgggtgaaactaatgacgatgttgtgtctgtgc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52113461 |
cgggtgaaactaatgacgatgttgtgtctgtgc |
52113493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 54
Target Start/End: Complemental strand, 12505235 - 12505202
Alignment:
| Q |
21 |
ttgggtttgaggaaatgaatgggcctggtggcat |
54 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
12505235 |
ttgggtttgaggaaatgaatggacctggtggcat |
12505202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University