View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_high_24 (Length: 240)
Name: NF11018_high_24
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 4760456 - 4760248
Alignment:
| Q |
14 |
gcaaaggagtacacaaaattttgtgaggaagaagatgctgcacattgaaattaattt-caatatatgggactgactcnnnnnnnatatatgtactatgat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4760456 |
gcaaaggagtacacaaaattttgtgaggaagaagatgctgcacattgaaattaattttcaatatatgggactgactctttttttatatatgtactatgat |
4760357 |
T |
 |
| Q |
113 |
attgttatctactttcttcaagtgcaatagaattgcttcaagttgttattgttttttccttgctattattgtcattgttaccgacacttcagtgtgtcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4760356 |
attgttatctactttcttcaagtgcaatagaattgcttcaagttgttattgttctttccttgctactattgtcattgttaccgacacttcagtgtgtcag |
4760257 |
T |
 |
| Q |
213 |
tctttctat |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
4760256 |
tctttctat |
4760248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University