View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_high_5 (Length: 519)
Name: NF11018_high_5
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 4880345 - 4880396
Alignment:
| Q |
5 |
ttggtttgtgttggaacaatagttggtcaaatagtctatgattgtattcttt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4880345 |
ttggtttgtgttggaacaatagttggtcaaatagtctatgattgtattcttt |
4880396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 474
Target Start/End: Original strand, 4880520 - 4880572
Alignment:
| Q |
422 |
ttgtgataatttaagtgtagtttatccttccaataacgccgttcaacatcaac |
474 |
Q |
| |
|
|||||||||| |||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
4880520 |
ttgtgataatgtaagtgtagtttatccttatgacaaccccgttcaacatcaac |
4880572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 40460612 - 40460554
Alignment:
| Q |
365 |
gcttaggaacttactcttggagcttttctgtcttgtcacgaagactattttagtctatt |
423 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |||| ||| ||||||||||| |
|
|
| T |
40460612 |
gcttaggaacttacttttggagctttattgtcttgtcatgaaggctactttagtctatt |
40460554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University