View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11018_low_17 (Length: 297)

Name: NF11018_low_17
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11018_low_17
NF11018_low_17
[»] chr3 (1 HSPs)
chr3 (115-276)||(27599292-27599442)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 115 - 276
Target Start/End: Original strand, 27599292 - 27599442
Alignment:
115 ctctctcattcaatcacttaatttagtggcaatcaaatttttatggttccttctattgaagttgatcctattttacttcaaaataaaccaccgatattaa 214  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||           | | |||||||||||||    
27599292 ctctctcattcaatcacttaatttactggcaatcaaatttttatggttccttctattgaagttgatcctatt-----------tgagccaccgatattaa 27599380  T
215 atatgagcacctttcatagtcgagatttgaacttcaatttacgatgttatgggagtttagtc 276  Q
    |||||||||||||||||||||  ||||||||||||| ||||| |||||||||||||||||||    
27599381 atatgagcacctttcatagtcaggatttgaacttcagtttaccatgttatgggagtttagtc 27599442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University