View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_low_20 (Length: 253)
Name: NF11018_low_20
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 28549822 - 28549598
Alignment:
| Q |
7 |
ttatgtttgcacattttctttcctctaatgcgacaacaataattgtgtagtaacaacagttaaaacattgattgtgtcnnnnnnn--tgtaacattgaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||| ||| |
|
|
| T |
28549822 |
ttatgtttgcacattttctttcctctaatgcgacaacaataattgtgtagtagcaacagttaaa-------ttgtgtcaaaaaaaaatgtaacatgaaaa |
28549730 |
T |
|
| Q |
105 |
taacaggaaagatatgagaggaatttcatgtacaaattgattatagagtttggtccaaaaaagaagacctgcatctctaggagagacgagctcttccact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28549729 |
taacaggaaagatatgagaggaatttcatgtacaaattgattatagagtttggtccaaaaaagaagacctgcatctctaggagagacgagctcttccact |
28549630 |
T |
|
| Q |
205 |
atcaatcgaaaaatttgaatcatgcagttggt |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
28549629 |
atcaatcgaaaaatttgaatcatacagttggt |
28549598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University