View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_low_21 (Length: 248)
Name: NF11018_low_21
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 5460620 - 5460399
Alignment:
| Q |
11 |
gtgagaagaagattgaacaggtatcgattaggcctaaaggcatacagattatttactcaaggattatgaatatctttgagactataacctccgaattaag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460620 |
gtgacaagaagattgaacaggtatcgattaggcctaaaggcatacagattatttactcaaggattatgaatatctttgagactataacctccgaattaag |
5460521 |
T |
 |
| Q |
111 |
atgaaataaagttaccaaatctctattttgtcacttaacaaagcataataagagctatataaagccttct-ttttcttccttatgttcactcctttgaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5460520 |
atgaaataaagttaccaaatctctattttgtcacttaacagagcataataagagctatataaagccttcttttttcttccttatgttcactcctttgaac |
5460421 |
T |
 |
| Q |
210 |
tgccatcagctgagaccttagt |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5460420 |
tgccatcagctgagaccttagt |
5460399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University