View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11018_low_25 (Length: 235)
Name: NF11018_low_25
Description: NF11018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11018_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 47543847 - 47544052
Alignment:
| Q |
16 |
cacagacatctgatccttatgaacttggacttcagcctactgtaaaaggtttgaattgttaaacacatttgtatgcaattatgaagtttaacatagaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47543847 |
cacagacatctgatccttatgaacttggacttcatcctactgcaaaaggtttgaattgttaaacacatttgtatgcaattatgaagtttaacatagaaaa |
47543946 |
T |
|
| Q |
116 |
catttgcatgggaaatttataaaagttatccgtcttttgtattttatttatctgtagagtgtggccctgctggagctccttccatgccacagaaacctgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47543947 |
catttgcatgggaaatttataaaagttatccgtcttttgtattttatttatctgtagagtgtggccctgctggagctccttccatgccacagaaacctgt |
47544046 |
T |
|
| Q |
216 |
tgttac |
221 |
Q |
| |
|
|||||| |
|
|
| T |
47544047 |
tgttac |
47544052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 115 - 153
Target Start/End: Complemental strand, 10266952 - 10266914
Alignment:
| Q |
115 |
acatttgcatgggaaatttataaaagttatccgtctttt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10266952 |
acatttgcatgggaaatttataaaagttatccgtatttt |
10266914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University